Review





Similar Products

93
Addgene inc sequence 5 ggatgtaagtttgccagaagc
Sequence 5 Ggatgtaagtttgccagaagc, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sequence 5 ggatgtaagtttgccagaagc/product/Addgene inc
Average 93 stars, based on 1 article reviews
sequence 5 ggatgtaagtttgccagaagc - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

93
Addgene inc sequence 5 gctcatggagactaggtttgg
Sequence 5 Gctcatggagactaggtttgg, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sequence 5 gctcatggagactaggtttgg/product/Addgene inc
Average 93 stars, based on 1 article reviews
sequence 5 gctcatggagactaggtttgg - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

93
Addgene inc sequence 5 gctccaacgagaagctatttg
Sequence 5 Gctccaacgagaagctatttg, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sequence 5 gctccaacgagaagctatttg/product/Addgene inc
Average 93 stars, based on 1 article reviews
sequence 5 gctccaacgagaagctatttg - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

94
Addgene inc sequence 5 gttcagatgtgcggcgagt
Sequence 5 Gttcagatgtgcggcgagt, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sequence 5 gttcagatgtgcggcgagt/product/Addgene inc
Average 94 stars, based on 1 article reviews
sequence 5 gttcagatgtgcggcgagt - by Bioz Stars, 2026-04
94/100 stars
  Buy from Supplier

96
Addgene inc aav plasmids encoding shrna sequences
Aav Plasmids Encoding Shrna Sequences, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/aav plasmids encoding shrna sequences/product/Addgene inc
Average 96 stars, based on 1 article reviews
aav plasmids encoding shrna sequences - by Bioz Stars, 2026-04
96/100 stars
  Buy from Supplier

96
Santa Cruz Biotechnology sirna sequences
Sirna Sequences, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sirna sequences/product/Santa Cruz Biotechnology
Average 96 stars, based on 1 article reviews
sirna sequences - by Bioz Stars, 2026-04
96/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology sirna sequences human chk1
Sirna Sequences Human Chk1, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sirna sequences human chk1/product/Santa Cruz Biotechnology
Average 93 stars, based on 1 article reviews
sirna sequences human chk1 - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

96
Santa Cruz Biotechnology sequence shrna
a Schematic <t>of</t> <t>Gck</t> virogenetic <t>shRNA</t> or control shRNA silencing surgery in the major taste fields of the tongue. b Schematic of brief access taste test of maltose and sucrose in lickometer. c Mean (±SEM) lick score of 0.316M, 0.56M, 1.1M maltose and sucrose in control (n=11) and GCK KD (n=12) TRPM5+. d Mean lick scores averaged across concentration for control and GCK KD TRPM5+ (11-12/group). e Mean (±SEM) 0.316M, 0.56M, 1.1M maltose and sucrose in control (n=10) and GCK KD (n=11) TRPM5-. f Mean lick scores averaged across concentration for control and GCK KD TRPM5- (10-11/group). g Mean relative transcript expression of Mgam for B6 (n=8), TRPM5+ (n=8) and TRPM5- (n=9). h Mean (±SEM) relative MGAM transcript for B6 sugar naïve (n=2), glucose experience (n=5), fructose experience (n=6), or glucose + fructose experience(n=5). (*:p<0.05, **:p<0.01,***:p<0.001,****:p<0.0001). All tests were conducted in the Davis Rig. Statistical Analysis are in Supplementary Table 3.
Sequence Shrna, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sequence shrna/product/Santa Cruz Biotechnology
Average 96 stars, based on 1 article reviews
sequence shrna - by Bioz Stars, 2026-04
96/100 stars
  Buy from Supplier

96
Addgene inc control shrna sequence
a Schematic <t>of</t> <t>Gck</t> virogenetic <t>shRNA</t> or control shRNA silencing surgery in the major taste fields of the tongue. b Schematic of brief access taste test of maltose and sucrose in lickometer. c Mean (±SEM) lick score of 0.316M, 0.56M, 1.1M maltose and sucrose in control (n=11) and GCK KD (n=12) TRPM5+. d Mean lick scores averaged across concentration for control and GCK KD TRPM5+ (11-12/group). e Mean (±SEM) 0.316M, 0.56M, 1.1M maltose and sucrose in control (n=10) and GCK KD (n=11) TRPM5-. f Mean lick scores averaged across concentration for control and GCK KD TRPM5- (10-11/group). g Mean relative transcript expression of Mgam for B6 (n=8), TRPM5+ (n=8) and TRPM5- (n=9). h Mean (±SEM) relative MGAM transcript for B6 sugar naïve (n=2), glucose experience (n=5), fructose experience (n=6), or glucose + fructose experience(n=5). (*:p<0.05, **:p<0.01,***:p<0.001,****:p<0.0001). All tests were conducted in the Davis Rig. Statistical Analysis are in Supplementary Table 3.
Control Shrna Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/control shrna sequence/product/Addgene inc
Average 96 stars, based on 1 article reviews
control shrna sequence - by Bioz Stars, 2026-04
96/100 stars
  Buy from Supplier

Image Search Results


a Schematic of Gck virogenetic shRNA or control shRNA silencing surgery in the major taste fields of the tongue. b Schematic of brief access taste test of maltose and sucrose in lickometer. c Mean (±SEM) lick score of 0.316M, 0.56M, 1.1M maltose and sucrose in control (n=11) and GCK KD (n=12) TRPM5+. d Mean lick scores averaged across concentration for control and GCK KD TRPM5+ (11-12/group). e Mean (±SEM) 0.316M, 0.56M, 1.1M maltose and sucrose in control (n=10) and GCK KD (n=11) TRPM5-. f Mean lick scores averaged across concentration for control and GCK KD TRPM5- (10-11/group). g Mean relative transcript expression of Mgam for B6 (n=8), TRPM5+ (n=8) and TRPM5- (n=9). h Mean (±SEM) relative MGAM transcript for B6 sugar naïve (n=2), glucose experience (n=5), fructose experience (n=6), or glucose + fructose experience(n=5). (*:p<0.05, **:p<0.01,***:p<0.001,****:p<0.0001). All tests were conducted in the Davis Rig. Statistical Analysis are in Supplementary Table 3.

Journal: bioRxiv

Article Title: An enzymatic–metabolic sensing axis in taste cells detects glucose-yielding carbohydrates

doi: 10.64898/2026.03.13.710876

Figure Lengend Snippet: a Schematic of Gck virogenetic shRNA or control shRNA silencing surgery in the major taste fields of the tongue. b Schematic of brief access taste test of maltose and sucrose in lickometer. c Mean (±SEM) lick score of 0.316M, 0.56M, 1.1M maltose and sucrose in control (n=11) and GCK KD (n=12) TRPM5+. d Mean lick scores averaged across concentration for control and GCK KD TRPM5+ (11-12/group). e Mean (±SEM) 0.316M, 0.56M, 1.1M maltose and sucrose in control (n=10) and GCK KD (n=11) TRPM5-. f Mean lick scores averaged across concentration for control and GCK KD TRPM5- (10-11/group). g Mean relative transcript expression of Mgam for B6 (n=8), TRPM5+ (n=8) and TRPM5- (n=9). h Mean (±SEM) relative MGAM transcript for B6 sugar naïve (n=2), glucose experience (n=5), fructose experience (n=6), or glucose + fructose experience(n=5). (*:p<0.05, **:p<0.01,***:p<0.001,****:p<0.0001). All tests were conducted in the Davis Rig. Statistical Analysis are in Supplementary Table 3.

Article Snippet: Briefly, mice were anesthetized with isoflurane (5% induction rate; 2-3% maintenance rate, as needed) to receive a scrambled sequence shRNA (Control, sc-108080, Santa Cruz Biotechnology), GCK shRNA (sc-35459-V, Santa Cruz Biotechnology), or Maltase-Glucoamylase shRNA (m) (sc-75741-V, Santa Cruz Biotechnology).

Techniques: shRNA, Control, Concentration Assay, Expressing

a Schematic of control and Mgam virogenetic shRNA silencing surgery in the major taste fields of the tongue. b Mean relative transcript expression of Mgam, Gck, and Tas1r3 in control (n= 4) and MGAM KD (n=4) in TRPM5+ mice c Schematic of burst structure (period of continuous licks separated by <1s) and time frame d Schematic of 300 lick test of 0.6M maltose in lickometer. e Schematical graph showing relationship between burst size and hedonic value. f Mean (±SEM) burst size, burst number, total licks for 300 lick test in control (n=3) and MGAM KD (n=3) in TRPM5+ mice (*:p<0.05). All tests were conducted in the gustometer. Statistical Analysis are in .

Journal: bioRxiv

Article Title: An enzymatic–metabolic sensing axis in taste cells detects glucose-yielding carbohydrates

doi: 10.64898/2026.03.13.710876

Figure Lengend Snippet: a Schematic of control and Mgam virogenetic shRNA silencing surgery in the major taste fields of the tongue. b Mean relative transcript expression of Mgam, Gck, and Tas1r3 in control (n= 4) and MGAM KD (n=4) in TRPM5+ mice c Schematic of burst structure (period of continuous licks separated by <1s) and time frame d Schematic of 300 lick test of 0.6M maltose in lickometer. e Schematical graph showing relationship between burst size and hedonic value. f Mean (±SEM) burst size, burst number, total licks for 300 lick test in control (n=3) and MGAM KD (n=3) in TRPM5+ mice (*:p<0.05). All tests were conducted in the gustometer. Statistical Analysis are in .

Article Snippet: Briefly, mice were anesthetized with isoflurane (5% induction rate; 2-3% maintenance rate, as needed) to receive a scrambled sequence shRNA (Control, sc-108080, Santa Cruz Biotechnology), GCK shRNA (sc-35459-V, Santa Cruz Biotechnology), or Maltase-Glucoamylase shRNA (m) (sc-75741-V, Santa Cruz Biotechnology).

Techniques: Control, shRNA, Expressing

a Schematic depicting T1R2+T1R3 sweet receptor transgenic knockout mouse. b Mean transcript expression of Gck and Mgam for sugar naive (n=4) and sugar exposed (n=4) T1RKO. c Schematic of control and Mgam virogenetic shRNA silencing surgery in the major taste fields of the tongue. d Schematic of brief access taste test of maltose and sucrose in lickometer. e Block 1 mean (±SEM) lick scores for 0.316M, 0.56M, 1.1M maltose and sucrose in control (n=5) and MGAM KD (n=5) T1RKO. f Mean lick scores averaged across concentration for control and MGAM KD for first block (5/group). g Schematic of brief access taste test of glucose and fructose in lickometer. h First block mean (±SEM) lick scores for 0.316M, 0.56M, 1.1M glucose and fructose in control (n=6) and MGAM KD (n=5) T1RKO. i First block glucose and fructose mean lick scores averaged across concentration for control (n=6) and MGAM KD (n=5) T1RKO. All tests were conducted in the Davis Rig. (*:p<0.05, **:p<0.01, ***:p<0.001, ****:p<0.0001). Statistical Analysis are in Supplementary Table 7.

Journal: bioRxiv

Article Title: An enzymatic–metabolic sensing axis in taste cells detects glucose-yielding carbohydrates

doi: 10.64898/2026.03.13.710876

Figure Lengend Snippet: a Schematic depicting T1R2+T1R3 sweet receptor transgenic knockout mouse. b Mean transcript expression of Gck and Mgam for sugar naive (n=4) and sugar exposed (n=4) T1RKO. c Schematic of control and Mgam virogenetic shRNA silencing surgery in the major taste fields of the tongue. d Schematic of brief access taste test of maltose and sucrose in lickometer. e Block 1 mean (±SEM) lick scores for 0.316M, 0.56M, 1.1M maltose and sucrose in control (n=5) and MGAM KD (n=5) T1RKO. f Mean lick scores averaged across concentration for control and MGAM KD for first block (5/group). g Schematic of brief access taste test of glucose and fructose in lickometer. h First block mean (±SEM) lick scores for 0.316M, 0.56M, 1.1M glucose and fructose in control (n=6) and MGAM KD (n=5) T1RKO. i First block glucose and fructose mean lick scores averaged across concentration for control (n=6) and MGAM KD (n=5) T1RKO. All tests were conducted in the Davis Rig. (*:p<0.05, **:p<0.01, ***:p<0.001, ****:p<0.0001). Statistical Analysis are in Supplementary Table 7.

Article Snippet: Briefly, mice were anesthetized with isoflurane (5% induction rate; 2-3% maintenance rate, as needed) to receive a scrambled sequence shRNA (Control, sc-108080, Santa Cruz Biotechnology), GCK shRNA (sc-35459-V, Santa Cruz Biotechnology), or Maltase-Glucoamylase shRNA (m) (sc-75741-V, Santa Cruz Biotechnology).

Techniques: Transgenic Assay, Knock-Out, Expressing, Control, shRNA, Blocking Assay, Concentration Assay

a Schematic showing control, Gck, and Mgam virogenetic shRNA silencing surgery in the major taste fields of the tongue. b Schematic of 1000 lick test of mixed nutrient solution (Peptamen) in lickometer for pre-surgery and post-surgery. c Mean total licks for 1000 lick test in control, GCK KD, MGAM KD pre-test vs post-test. d Mean meal duration for 1000 lick test in control, GCK KD, MGAM KD pre-test vs post-test. e Mean burst size for 1000 lick test in control, GCK KD, MGAM KD pre-test vs post-test. f Mean burst number for 1000 lick test in control, GCK KD, MGAM KD pre-test vs post-test. g Mean (±SEM) cumulative first 15 burst size for 1000 lick test in control, GCK KD, MGAM KD pre-test vs post-test. (n=12/group for all tests) (*:p<0.05, **:p<0.01, ***:p<0.001, ****:p<0.0001). All tests were conducted in the gustometer. Statistical Analysis are in Supplementary Table 8.

Journal: bioRxiv

Article Title: An enzymatic–metabolic sensing axis in taste cells detects glucose-yielding carbohydrates

doi: 10.64898/2026.03.13.710876

Figure Lengend Snippet: a Schematic showing control, Gck, and Mgam virogenetic shRNA silencing surgery in the major taste fields of the tongue. b Schematic of 1000 lick test of mixed nutrient solution (Peptamen) in lickometer for pre-surgery and post-surgery. c Mean total licks for 1000 lick test in control, GCK KD, MGAM KD pre-test vs post-test. d Mean meal duration for 1000 lick test in control, GCK KD, MGAM KD pre-test vs post-test. e Mean burst size for 1000 lick test in control, GCK KD, MGAM KD pre-test vs post-test. f Mean burst number for 1000 lick test in control, GCK KD, MGAM KD pre-test vs post-test. g Mean (±SEM) cumulative first 15 burst size for 1000 lick test in control, GCK KD, MGAM KD pre-test vs post-test. (n=12/group for all tests) (*:p<0.05, **:p<0.01, ***:p<0.001, ****:p<0.0001). All tests were conducted in the gustometer. Statistical Analysis are in Supplementary Table 8.

Article Snippet: Briefly, mice were anesthetized with isoflurane (5% induction rate; 2-3% maintenance rate, as needed) to receive a scrambled sequence shRNA (Control, sc-108080, Santa Cruz Biotechnology), GCK shRNA (sc-35459-V, Santa Cruz Biotechnology), or Maltase-Glucoamylase shRNA (m) (sc-75741-V, Santa Cruz Biotechnology).

Techniques: Control, shRNA